Menu

INTRODUCTION In the first 3 practical sessions

0 Comment

INTRODUCTION
In the first 3 practical sessions, we will isolate our own DNA and perform polymerase chain reaction (PCR) to intensify an area after our own DNA to create a personal fingerprint. While DNA from dissimilar individuals is 99.9% alike, here are mutable areas that are polymorphic and deliver the foundation for hereditary disease analysis, forensic identification, and paternity testing.
There are 3 main kinds of genetic variation between persons; VNTR (Variable Number of Tandem Repeats), STR (Short Tandem Repeats) and SNP (Single Nucleotide Polymorphism). The VNTR difference is composed of recurrent copies of a DNA order that lie adjacent to one another. In this experiment, we will amplify a noncoding region of chromosome 1 covering a VNTR called D1S8O, which has a recurrence component of 16 base pairs. At this locus, most persons have alleles covering between 14 and 40 repeats, which are congenital in a Mendelian style on the maternal and paternal copies of chromosome 1.
In the fourth practical session, we will undertake a diagnostic study in a patient circumstance education by execution quantitative real-time PCR (QRT-PCR) using cDNA derived from biopsy tissue and measuring levels of look of genes known to be perversely spoken in breast cancer using the ?? Comparative Threshold Cycle (?? CT) technique.
METHODS
A brief summary of the DNA isolation and RT-PCR methods
We will obtain two samples of our own cheek cells using a particular brush, and too a saline mouth wash. The cells will be resuspended in a answer covering the resin “Chelex” which quandaries metal ions. These metal ions can turn as catalysts in the failure of DNA at high temperatures and they can constrain the PCR response. The cells are lysed by steaming and centrifuged to eliminate cell debris. A example of the supernatant which covers chromosomal DNA is used in a PCR response. This reaction contains a heat-stable Taq polymerase, small oligonucleotide primers, and the four deoxynucleotide building blocks of DNA, and MgCl2 in a buffered clarification. The PCR mixture is located in a DNA thermal cycler and taken through 35 cycles of amplification. The D1S80 area that is augmented by PCR will be examined by agarose gel electrophoresis. The PCR primers used in this experiment bracket the D1S8O locus and selectively amplify that region of chromosome 1. Following PCR amplification, the DNA is separated according to size, using agarose gel electrophoresis. After discoloration with ethidium bromide, one or two bands are typically noticeable. This indicates that an individual is either homozygous or heterozygous for the D1S8O locus. Different alleles appear as distinct bands each composed of several million copies of the amplified allele. A band’s position on the gel indicates the size (i.e., amount of recurrence units) of a DlS8O allele: lesser alleles move a lengthier distance from their origin, while bigger alleles move a smaller distance.
RESULTS
Pureness and Amount of DNA
Model A Model B
A260nm 0.071 0.077
A280nm 0.062 0.065
Pureness (A260nm/ A280nm) 1.15 1.18
DNA (µg/ml) * 142 154
*1 Absorption unit (260nm) = 50 µg/ml
DF=Vf/Vi= (195+5) µl /5 µl =40
DNA=OD at 260 * dilution factor * 50 µg/ml
Gel Electrophoresis

Fig. Agarose gel electrophoresis results with the PCR product and DNA ladder.

PCR sample is in the ninth lane. The sample have 2 fragments between 300 bp to 800 bp. The size of the fragment is thicker a bigger in size for the DNA ladder.
The sample size is 501.2 bp molecular weight. The distance migration of the sample is 16 mm.

Fig. A standard curve of the log (MW) versus Rf to determining the MW of an unknown protein.
NO. Of Tandem Repeats
; D1S80 PCR product
1. Dilution of the two DNA samples. Set up the following 2 tubes:
Example 1 – add 7 µl of Human genomic DNA (Model A or Model B) to 693 µL.
Example 2 – add 7 µl of D1S80 PCR product to 693 µL of Tris/borate/EDTA buffer.
2. We placed tubes 1 and 4 at room temperature.
3. We Placed tubes 2, 3, 5, and 6 in a 100°C heating block for 5 minutes.
4. Now removing tubes 2 and 5 from the heating block and quickly cools by placing directly into a freeze bath for a least of 5 minutes.
5. Removing tubes 3 and 6 after the heating block and placing at 70°C for 15 minutes. Then placing the tubes at room temperature for 10 minutes.
SYBR Green
Quantitation of double-stranded DNA by a fluorescent examines:
The fluorescent particle SYBR Green shows exceptional affinity for dsDNA and a large fluorescent improvement upon DNA binding. The affinity of SYBR Green is ;100 fold larger for dsDNA compared to single stranded molecules (ssDNA or RNA).
SYBR Green is extremely excited at 497 nm and has a release extreme of 520 nm. See excitation / emission spectrum of dsDNA – bound SYBR Green (below).

Tube 7 8 9 10 11 12
DNA standard 2.0 mg/mL: (?l) 0 4 10 20 40 100
Tris/borate/EDTA buffer (?l) 200 196 190 180 160 100
Final DNA in tube (?g/mL) 0 0.04 0.1 0.2 0.4 1.00
Absorption – blank nm 0 10034 26830 50553 100112 206717

Fig. Raw data of a SYBR green fluorescent assay from the plate-reader

Table. UV absorbance readings and concentration (ug/mL) of diluted Human DNA (?l) and diluted D1S80 PCR product (?l).
Tube 1 2 3 4 5 6
control Quick chill Slow cool control Quick chill Slow cool
Absorption– blank nm 18172 16346 18968 231241 38894 41490
0.084 0.076 0.088 1.077 0.181 0.193

Fig. A standard curve of the DNA concentration versus absorption at 485nm/535nm to determine the unknown DNA concentration (?g/ml).
Table. DNA concentrations for Human genomic DNA and D1S80 PCR product.
Human DNA (Sample A or B) µg/ml D1S80 PCR product µg/ml
DNA: control 8.4 107.7
DNA: quickly chilled 7.6 18.1
DNA: slow cool 8.8 19.3

DF=Vf/Vi= (693+7) µl /7 µl =100
Principles and procedures of RNA isolation

Healthy Control Patient
A260nm 0.219 0.188
A280nm 0.115 0.102
Purity (A260nm /A280nm) 1.9 1.84
RNA (?g/ml) 109.5 94
Total RNA yield (?g) 1.095 0.94
RNA yield after quantification (?g)

dilution factor =Vf/Vi= (90+10) µl /10 µl =10
Total yield =concentration x volume of sample(ml) = 109.5 µg/ml x 0.01 ml=1.095 ?g

Taqman Gene Expression Assays
Graph of the HER-2 gene expression between patient and fit control

Table. The calculation of the average fold difference in BRCA1 and HER-2 gene expression between the patient and healthy control.
BRCA1 Av Ct SD of BRCA1 BRCA1 ?Ct BRCA1 ?SD GAPDH Av Ct SD of GAPDH ??Ct ??Ct+?SD ??Ct-?SD Fold Diff (Upper) Fold Diff (Lower) Average Fold Diff
Healthy Control 28.46 0.17 4.92 0.46 23.54 0.42 0.00 0.46 -0.46 0.73 1.37 1.05
Patient 29.88 0.15 5.82 0.15 24.07 0.04 0.89 1.05 0.74 0.48 0.60 0.54

HER-2 Av Ct SD of HER-2 HER-2 ?Ct HER-2 ?SD GAPDH Av Ct SD of GAPDH ??Ct ??Ct+?SD ??Ct-?SD Fold Diff (Upper) Fold Diff (Lower) Average Fold Diff
Healthy Control 32.80 0.35 9.26 0.55 23.54 0.42 0.00 0.55 -0.55 0.68 1.46 1.07
Patient 29.14 0.00 5.07 0.04 24.07 0.04 -4.18 -4.14 -4.22 17.67 18.62 18.14

gen CT value average SD
Patient BRCA1 29.77524 29.88095 0.149497
Patient BRCA1 29.98667
Patient HER-2 29.14051 29.13969 0.001149
Patient HER-2 29.13888
Patient GAPDH 24.03858 24.06526 0.037734
Patient GAPDH 24.09194
Healthy Control BRCA1 28.57914 28.46213 0.165481
Healthy Control BRCA1 28.34512
Healthy Control HER-2 32.54721 32.79509 0.350555
Healthy Control HER-2 33.04297
Healthy Control GAPDH 23.84023 23.53978 0.424902
Healthy Control GAPDH 23.23933
no cDNA Control BRCA1 Undetermined
no cDNA Control BRCA1 Undetermined
no cDNA Control HER-2 Undetermined
no cDNA Control HER-2 Undetermined
no cDNA Control GAPDH Undetermined
no cDNA Control GAPDH Undetermined
DISCUSSION
Comparison to general population
The results of my test had 2 bands which clearly shows that i am heterozygous but when compared to the result of class which has 36 students in total, there is a total of 21 students whose test results showed 2 bands and hence they are heterozygous and the tests of 12 students showed one band only which makes them homozygous. But there were 3 students whose test showed no bands between 300 to 800bp.
So, a total of 58.33% of the class students are heterozygous, 33.33% of the class students are homozygous while 3 students showed no bands.
primer and genome sequences
5′
GAAACTGGCCTCCAAACACTGCCCGCCGTCCACGGCCGGCCGGTCCTGCGTGTGAATGACTCA
GGAGCGTATTCCCCACGCGCCAGCACTGCATTCAGATAAGCGCTGGCTCAGT
GTCAGCCCAAGGAAGA
CAGACCACAGGCAAGG
AGGACCACCGGAAAGG
AAGACCACCGGAAAGG
AAGACCACCGGAAAGG
AAGACCACAGGCAAGG
AGGACCACCGGAAAGG
AAGACCACCGGCAAGG
AGGACCACCGGCAAGG
AGGACCACCAGGAAGG
AGGACCACCAGCAAGG
AGGACCACCAGCAAGG
AGGACCACCAGGAAGG
AGGACCACCAGGAAGG
AGGACCACCGGCAAGG
AGGACCACCAGGAAGG
AGGACCACCAGGAAGG
AGGACCACCGGCAAGG
AGGACCACCAGGAAGG
AGAACCACCAGGAAGG
AGGACCACCAGGAAGG
AGGACCACCAGGAAGG
AGGACCACTGGCAAGG
AAGACCACCGGCAAGC
CTGCAAGGGGCACGTGCATCTCCAACAAGAC 3′

Comparison of Concentration values of DNA sample A or B
Sample A Sample B
A260nm 0.071 0.077
A280nm 0.062 0.065
Purity (A260nm/ A280nm) 1.15 1.18
DNA (µg/ml) * 142 154
*1 Absorption unit (260nm) = 50 µg/ml
DF=Vf/Vi= (195+5) µl /5 µl =40
DNA=OD at 260 * dilution factor * 50 µg/ml
Tube 7 8 9 10 11 12
DNA standard 2.0 ?g/mL: (?l) 0 4 10 20 40 100
Tris/borate/EDTA buffer (?l) 200 196 190 180 160 100
Final DNA in tube (?g/mL) 0 0.04 0.1 0.2 0.4 1.00
Absorption – blank nm 0 10034 26830 50553 100112 206717

Analysis of DNA Samples values that were incubated at 1000 C

Isolation of RNA considering the guanidium acid thiocyanate phenol extraction method
In order to prepare the cDNA templates of normal healthy controls and patients we will perform Practical Session 4, RNA must first be isolated from these individuals and quantified. 5µg of RNA is measured by determining the absorbance readings at 260nm using a UV spectrophotometer and the formula = Absorbance260nm x dilution factor x 40 µg RNA/ml/absorbance unit. The quantified RNA is then reverse transcribed to synthesis cDNA. This method lets the discovery of little plenty RNAs in a model, and making of the matching cDNA, thereby easing the duplicating of low duplicate genes.
As the procedures of RNA isolation and cDNA synthesis require the use of toxic/carcinogenic reagents and large quantities of time.

Purity of RNA samples used in the cDNA synthesis
Healthy Control Patient
A260nm 0.219 0.188
A280nm 0.115 0.102
Purity (A260nm /A280nm) 1.9 1.84
RNA (?g/ml) 109.5 94
Total RNA yield (?g) 1.095 0.94
RNA yield after quantification (?g)
dilution factor =Vf/Vi= (90+10) µl /10 µl =10
Total yield =concentration x volume of sample(ml) = 109.5 µg/ml x 0.01 ml=1.095 ?g
cDNA Synthesis Reaction
To prepare the cDNA templates of normal healthy controls and patients required
for the quantitative real-time polymerase chain reaction (QRT-PCR) in Practical
Session 4, RNA must first be isolated from these individuals and quantified. 5µg of RNA is measured by determining the absorbance readings at 260nm using a UV spectrophotometer and the formula = Absorbance260nm x dilution factor x 40 µg RNA/ml/absorbance unit. . The quantified RNA is then reverse transcribed to synthesis cDNA. This method lets the discovery of little plenty RNAs in a model, and making of the matching cDNA, thereby easing the duplicating of low duplicate genes.
As the procedures of RNA isolation and cDNA synthesis require the use of toxic/carcinogenic reagents and large quantities of time, RMIT staff members will perform these on our behalf.
Template for QRT-PCR
cDNA manufactured from DNA removed from a piece of biopsied breast tissue to do QRT-PCR to conclude the variations in the appearance of genes involved in the pathogenesis of breast cancer comparative to appearance stages in a usual fit single.
Enzyme for Transforming RNA into cDNA
Reverse Transcriptase is the enzyme which transforms RNA into cDNA
Reagents Essential For cDNA Synthesis

Breast Cancer

Graph of the HER-2 gene expression between patient and healthy control

gen CT value average SD
Patient BRCA1 29.77524 29.88095 0.149497
Patient BRCA1 29.98667
Patient HER-2 29.14051 29.13969 0.001149
Patient HER-2 29.13888
Patient GAPDH 24.03858 24.06526 0.037734
Patient GAPDH 24.09194
Healthy Control BRCA1 28.57914 28.46213 0.165481
Healthy Control BRCA1 28.34512
Healthy Control HER-2 32.54721 32.79509 0.350555
Healthy Control HER-2 33.04297
Healthy Control GAPDH 23.84023 23.53978 0.424902
Healthy Control GAPDH 23.23933
no cDNA Control BRCA1 Undetermined
no cDNA Control BRCA1 Undetermined
no cDNA Control HER-2 Undetermined
no cDNA Control HER-2 Undetermined
no cDNA Control GAPDH Undetermined
no cDNA Control GAPDH Undetermined

Other Candidate Gene for Breast Cancer
Such genes comprise the breast cancer 1 (BRCA1) and human epidermal growth factor receptor 2 (HER-2). BRCA1 gene encrypts a nuclear phosphoprotein that shows a role in upholding genomic constancy and it too perform as a tumor suppressor. Mutations in this gene are accountable for around 40% of inborn breast cancers. Other splicing plays a part in modulating the subcellular localization and physical function of this gene. So, downregulated BRCA1 gene appearance is usually originate in breast cancer patients. The HER-2 gene encrypts a fellow of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases and activates kinase-mediated activation of downstream signaling pathways, such as those including mitogen-activated protein kinase and phosphatidylinositol-3 kinase. An overexpression of this gene has been stated in breast tumors, mainly in those of an violent nature. In this practical session, we will run Taqman gene appearance examines to conclude the threshold cycle (CT) standards and quantify any variations in BRCA1 and HER-2 mRNA stages comparative to a reference gene (GAPDH; glyceraldehyde 3-phosphate dehydrogenase) in the patient. CT values attained from usual fit tissue will be used as a calibrator regulator in data analysis. This will benefit us to conclude if the swelling is expected to be a breast tumor.
Reference Genes
Glyceraldehyde 3-phosphate dehydrogenase CT values attained from usual fit tissue will be used as a calibrator control in data investigation. This will help us to conclude if the tumor is likely to be a breast tumor. Other gene that can be used as reference gene is Taqman gene.
Control in experiment
An endogenous control demonstrates gene appearance that is comparatively continuous and temperately plentiful through tissues and cell kinds and cure protocols. Standardization to endogenous control genes is presently the utmost precise technique to accurate for possible biases that are caused by: • Model gathering • Difference in the amount of initial material • Reverse transcription (RT) efficiency¢ • Nucleic acid (RNA/DNA) preparation and quality. No lone control can perform as a universal endogenous control for all experimental conditions; therefore we endorse confirming the selected endogenous control or set of controls for the sample tissue, cell, or treatment.
CONCLUSION
In this we have performed 4 practical sessions. In the first 3 practical sessions, we will separate our own DNA and perform polymerase chain reaction (PCR) to multiply a region from our own DNA to make a individual fingerprint. In the fourth practical session, we will take on a diagnostic study in a patient case study by carrying out quantitative real-time PCR (QRT-PCR) using cDNA derived from biopsy tissue and measuring stages of appearance of genes known to be abnormally expressed in breast cancer by the ??Comparative Threshold Cycle (??CT) technique.